Python script that parses BLAST output in XML (-outfmt 5 option) and converts
to SAM. It uses Biopython
module Bio.Blast.NCBIXML and has been tested on BLASTN 2.2.30+.
- No check is done (yet?) on whether reads have degenerate mappings.
Python script that parses BLAST output in XML (-outfmt 5 option) and converts
to SAM. It uses Biopython
module Bio.Blast.NCBIXML and has been tested on BLASTN 2.2.30+.
| #!/usr/bin/env python3.4 | |
| ''' Parse Blast output in XML with Biopython and converts to SAM (v1). | |
| Tested with Biopython 1.64 and BLASTN 2.2.30+ command | |
| blastn -task blastn -subject ref.fasta -query reads.fasta -outfmt 5 \ | |
| -out outblast.xml -word_size 7 -qcov_hsp_perc 0.3 | |
| There are m times n records in blast xml output file, where m is the number of | |
| sequences in the database (references) and n the number of queries (reads). | |
| record -> alignment -> hsp | |
| Record section | |
| -------------- | |
| {'alignments': [<Bio.Blast.Record.Alignment object at 0x7feebecda9b0>], | |
| 'application': 'BLASTN', | |
| 'blast_cutoff': (None, None), | |
| 'database': '', | |
| 'database_length': 0, | |
| 'database_letters': None, | |
| 'database_name': [], | |
| 'database_sequences': 0, | |
| 'date': '', | |
| 'descriptions': [<Bio.Blast.Record.Description object at 0x7feebecdaa58>], | |
| 'dropoff_1st_pass': (None, None), | |
| 'effective_database_length': None, | |
| 'effective_hsp_length': 4, | |
| 'effective_query_length': None, | |
| 'effective_search_space': 621.0, | |
| 'effective_search_space_used': None, | |
| 'expect': '10', | |
| 'filter': 'L;m;', | |
| 'frameshift': (None, None), | |
| 'gap_penalties': (5, 2), | |
| 'gap_trigger': (None, None), | |
| 'gap_x_dropoff': (None, None), | |
| 'gap_x_dropoff_final': (None, None), | |
| 'gapped': 0, | |
| 'hsps_gapped': None, | |
| 'hsps_no_gap': None, | |
| 'hsps_prelim_gapped': None, | |
| 'hsps_prelim_gapped_attemped': None, | |
| 'ka_params': (0.625, 0.41, 0.78), | |
| 'ka_params_gap': (None, None, None), | |
| 'matrix': '', | |
| 'multiple_alignment': None, | |
| 'num_good_extends': None, | |
| 'num_hits': None, | |
| 'num_letters_in_database': 0, | |
| 'num_seqs_better_e': None, | |
| 'num_sequences': None, | |
| 'num_sequences_in_database': 0, | |
| 'posted_date': [], | |
| 'query': '1X', | |
| 'query_id': 'Query_1', | |
| 'query_length': 13, | |
| 'query_letters': 13, | |
| 'reference': 'Stephen F. Altschul, Thomas L. Madden, Alejandro A. ' | |
| 'Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and ' | |
| 'David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new ' | |
| 'generation of protein database search programs", Nucleic ' | |
| 'Acids Res. 25:3389-3402.', | |
| 'sc_match': 2, | |
| 'sc_mismatch': -3, | |
| 'threshold': None, | |
| 'version': '2.2.30+', | |
| 'window_size': None} | |
| Alignment section | |
| ----------------- | |
| {'accession': 'Subject_1', | |
| 'hit_def': 'mock_ref', | |
| 'hit_id': 'Subject_1', | |
| 'hsps': [<Bio.Blast.Record.HSP object at 0x7f4034696ba8>], | |
| 'length': 73, | |
| 'title': 'Subject_1 mock_ref'} | |
| HSP section | |
| ----------- | |
| hsps is a list, one hsp is | |
| {'align_length': 13, | |
| 'bits': 19.32, | |
| 'expect': 0.000948843, | |
| 'frame': (1, 1), | |
| 'gaps': 0, | |
| 'identities': 12, | |
| 'match': '||| |||||||||', | |
| 'num_alignments': None, | |
| 'positives': 12, | |
| 'query': 'GACAGATTACAGT', | |
| 'query_end': 13, | |
| 'query_start': 1, | |
| 'sbjct': 'GACTGATTACAGT', | |
| 'sbjct_end': 64, | |
| 'sbjct_start': 52, | |
| 'score': 20.0, | |
| 'strand': (None, None)} | |
| SAM alignment mandatory fields | |
| 1 QNAME String [!-?A-~]{1, 255} Query template NAME | |
| 2 FLAG Int [0, 2^16 - 1] bitwise FLAG | |
| 3 RNAME String \*|[!-()+-<>-~][!-~]* Reference sequence NAME | |
| 4 POS Int [0, 2^31 - 1] 1-based leftmost mapping POSition | |
| 5 MAPQ Int [0, 255] MAPping Quality | |
| 6 CIGAR String \*|([0-9]+[MIDNSHPX=])+ CIGAR string | |
| 7 RNEXT String \*|=|[!-()+-<>-~][!-~]* Ref. name of the mate/next read | |
| 8 PNEXT Int [0,2^31 - 1] Position of the mate/next read | |
| 9 TLEN Int [-2^31 + 1, 2^31 - 1] observed Template LENgth | |
| 10 SEQ String \*|[A-Za-z=.]+ segment SEQuence | |
| 11 QUAL String [!-~]+ ASCII of Phred-scaled base QUALity + 33 | |
| ''' | |
| import sys | |
| import copy | |
| # from pprint import pprint | |
| from itertools import tee | |
| from math import log10 | |
| from Bio.Blast import NCBIXML | |
| NOMAPQ = False | |
| def_qual = 'I' | |
| # Usage | |
| try: | |
| filein = sys.argv[1] | |
| except KeyError: | |
| sys.exit("Usage: blast2sam2.py <in+blastn>\n") | |
| sam_line = ['', 0, None, 0, 0, None, '*', 0, 0, '*', '*'] | |
| def cigar(subject, query, queryStart, queryEnd, querySize): | |
| '''Build CIGAR representation from an HSP | |
| GTCCATGCAATTTTAAGACTTGAACCCCCTTGACTGATTACAGTCAGT original sequence: 48 bp | |
| 22 matches + 14 gaps + 26 matches = querySize: 62 bp | |
| GTCCATGCAATTTTAAGACTTG--------------AACCCCCTTGACTGATTACAGTCAGT query | |
| |||||||||||||||||||||| |||||||||||||||||||||||||| midline | |
| GTCCATGCAATTTTAAGACTTGAACCTGTGATCTGAAACCCCCTTGACTGATTACAGTCAGT subject | |
| ''' | |
| # To store CIGAR representation | |
| cigar_str = [] | |
| # Head clipping | |
| if queryStart > 1: | |
| cigar_str.append('%dH' % (queryStart - 1)) | |
| # Evaluate alignment position by position (always begin with a match) | |
| curType = "=" | |
| prevType = "=" | |
| count = 0 | |
| cigarsum = 0 | |
| assert len(query) == querySize | |
| length = len(query.replace('-', '')) | |
| # this loops over the alignment positions | |
| for i in range(querySize): | |
| # Current position type (deletion, insertion, match or mismatch) | |
| if query[i] == '-': | |
| curType = 'D' | |
| elif subject[i] == '-': | |
| curType = 'I' | |
| elif query[i] == subject[i]: | |
| curType = '=' | |
| else: | |
| curType = 'X' | |
| if curType == prevType: | |
| # Enlarge current segment | |
| prevType = curType | |
| count += 1 | |
| else: | |
| # Write current segment and start a new one | |
| cigar_str.append('%d%s' % (count, prevType)) | |
| if prevType in ['I', '=', 'X']: | |
| cigarsum += count | |
| prevType = curType | |
| count = 1 | |
| # Write last group | |
| cigar_str.append('%d%s' % (count, curType)) | |
| if curType in ['I', '=', 'X']: | |
| cigarsum += count | |
| # Tail clipping | |
| if queryEnd < length: | |
| # print(query, querySize, queryEnd, file=sys.stderr) | |
| cigar_str.append('%dH' % (length - queryEnd)) | |
| assert cigarsum == length, '%s: cigar:%s\tcigarsum=%d,length=%d' % \ | |
| (query, ''.join(cigar_str), cigarsum, length) | |
| # Join segments into a string | |
| return ''.join(cigar_str) | |
| # use itertools.tee() because we need the list twice | |
| blast_records, blast_records_backup = tee(NCBIXML.parse(open(filein))) | |
| # read once to parse general info | |
| version = None | |
| references = {} | |
| for record in blast_records: | |
| if not version: | |
| version = record.version | |
| application = record.application | |
| if record.alignments == []: | |
| continue | |
| for alignment in record.alignments: | |
| references[alignment.hit_def] = alignment.length | |
| # print header | |
| print('@HD\tVN:1.0\tSO:unsorted') | |
| for k, v in references.items(): | |
| print('@SQ\tSN:%s\tLN:%d' % (k, v)) | |
| print('@PG\tID:%s\tVN:%s\tCL:%s' % (application, version, ' '.join(sys.argv))) | |
| for record in blast_records_backup: | |
| for alignment in record.alignments: | |
| TC = len(alignment.hsps) # SAM TC flag: segments in template | |
| for hsp in alignment.hsps: | |
| to_print = copy.copy(sam_line) | |
| to_print[0] = record.query | |
| to_print[2] = alignment.hit_def | |
| to_print[3] = min(hsp.sbjct_start, hsp.sbjct_end) | |
| try: | |
| mapq = int(-log10(hsp.expect)) | |
| except ValueError: | |
| mapq = 127 | |
| if mapq > 254: | |
| to_print[4] = 254 | |
| elif mapq < 0: | |
| to_print[4] = 0 | |
| else: | |
| to_print[4] = mapq | |
| if NOMAPQ: | |
| to_print[4] = 255 | |
| if hsp.frame == (1, -1): | |
| to_print[1] |= 16 | |
| elif hsp.frame == (1, 1): | |
| pass | |
| else: | |
| sys.exit('What strand?') | |
| to_print[5] = cigar(hsp.sbjct, hsp.query, hsp.query_start, | |
| hsp.query_end, hsp.align_length) | |
| to_print[9] = hsp.query.replace('-', '') | |
| to_print[10] = def_qual * len(to_print[9]) | |
| to_print = [str(t) for t in to_print] | |
| print('\t'.join(to_print)) |
Hi. Sorry that I'm seeing this so late, I'm not even sure there are notifications on Gist.
In the version included in MinVar I map this to 127, but it's quite arbitrary. I'm not using the values anyway.
But thanks for pointing this out.
This script throws an error on line 234 when the e value for a blast hit is zero. A simple exception mapping hsp.expect=0 to mapq=254 should fix this...