Skip to content

Instantly share code, notes, and snippets.

@ozagordi
Last active July 28, 2019 05:22
Show Gist options
  • Select an option

  • Save ozagordi/099bdb796507da8d9426 to your computer and use it in GitHub Desktop.

Select an option

Save ozagordi/099bdb796507da8d9426 to your computer and use it in GitHub Desktop.
Converts BLAST output to SAM format

Python script that parses BLAST output in XML (-outfmt 5 option) and converts to SAM. It uses Biopython module Bio.Blast.NCBIXML and has been tested on BLASTN 2.2.30+.

Caveat emptor

  • No check is done (yet?) on whether reads have degenerate mappings.
#!/usr/bin/env python3.4
''' Parse Blast output in XML with Biopython and converts to SAM (v1).
Tested with Biopython 1.64 and BLASTN 2.2.30+ command
blastn -task blastn -subject ref.fasta -query reads.fasta -outfmt 5 \
-out outblast.xml -word_size 7 -qcov_hsp_perc 0.3
There are m times n records in blast xml output file, where m is the number of
sequences in the database (references) and n the number of queries (reads).
record -> alignment -> hsp
Record section
--------------
{'alignments': [<Bio.Blast.Record.Alignment object at 0x7feebecda9b0>],
'application': 'BLASTN',
'blast_cutoff': (None, None),
'database': '',
'database_length': 0,
'database_letters': None,
'database_name': [],
'database_sequences': 0,
'date': '',
'descriptions': [<Bio.Blast.Record.Description object at 0x7feebecdaa58>],
'dropoff_1st_pass': (None, None),
'effective_database_length': None,
'effective_hsp_length': 4,
'effective_query_length': None,
'effective_search_space': 621.0,
'effective_search_space_used': None,
'expect': '10',
'filter': 'L;m;',
'frameshift': (None, None),
'gap_penalties': (5, 2),
'gap_trigger': (None, None),
'gap_x_dropoff': (None, None),
'gap_x_dropoff_final': (None, None),
'gapped': 0,
'hsps_gapped': None,
'hsps_no_gap': None,
'hsps_prelim_gapped': None,
'hsps_prelim_gapped_attemped': None,
'ka_params': (0.625, 0.41, 0.78),
'ka_params_gap': (None, None, None),
'matrix': '',
'multiple_alignment': None,
'num_good_extends': None,
'num_hits': None,
'num_letters_in_database': 0,
'num_seqs_better_e': None,
'num_sequences': None,
'num_sequences_in_database': 0,
'posted_date': [],
'query': '1X',
'query_id': 'Query_1',
'query_length': 13,
'query_letters': 13,
'reference': 'Stephen F. Altschul, Thomas L. Madden, Alejandro A. '
'Sch&auml;ffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and '
'David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new '
'generation of protein database search programs", Nucleic '
'Acids Res. 25:3389-3402.',
'sc_match': 2,
'sc_mismatch': -3,
'threshold': None,
'version': '2.2.30+',
'window_size': None}
Alignment section
-----------------
{'accession': 'Subject_1',
'hit_def': 'mock_ref',
'hit_id': 'Subject_1',
'hsps': [<Bio.Blast.Record.HSP object at 0x7f4034696ba8>],
'length': 73,
'title': 'Subject_1 mock_ref'}
HSP section
-----------
hsps is a list, one hsp is
{'align_length': 13,
'bits': 19.32,
'expect': 0.000948843,
'frame': (1, 1),
'gaps': 0,
'identities': 12,
'match': '||| |||||||||',
'num_alignments': None,
'positives': 12,
'query': 'GACAGATTACAGT',
'query_end': 13,
'query_start': 1,
'sbjct': 'GACTGATTACAGT',
'sbjct_end': 64,
'sbjct_start': 52,
'score': 20.0,
'strand': (None, None)}
SAM alignment mandatory fields
1 QNAME String [!-?A-~]{1, 255} Query template NAME
2 FLAG Int [0, 2^16 - 1] bitwise FLAG
3 RNAME String \*|[!-()+-<>-~][!-~]* Reference sequence NAME
4 POS Int [0, 2^31 - 1] 1-based leftmost mapping POSition
5 MAPQ Int [0, 255] MAPping Quality
6 CIGAR String \*|([0-9]+[MIDNSHPX=])+ CIGAR string
7 RNEXT String \*|=|[!-()+-<>-~][!-~]* Ref. name of the mate/next read
8 PNEXT Int [0,2^31 - 1] Position of the mate/next read
9 TLEN Int [-2^31 + 1, 2^31 - 1] observed Template LENgth
10 SEQ String \*|[A-Za-z=.]+ segment SEQuence
11 QUAL String [!-~]+ ASCII of Phred-scaled base QUALity + 33
'''
import sys
import copy
# from pprint import pprint
from itertools import tee
from math import log10
from Bio.Blast import NCBIXML
NOMAPQ = False
def_qual = 'I'
# Usage
try:
filein = sys.argv[1]
except KeyError:
sys.exit("Usage: blast2sam2.py <in+blastn>\n")
sam_line = ['', 0, None, 0, 0, None, '*', 0, 0, '*', '*']
def cigar(subject, query, queryStart, queryEnd, querySize):
'''Build CIGAR representation from an HSP
GTCCATGCAATTTTAAGACTTGAACCCCCTTGACTGATTACAGTCAGT original sequence: 48 bp
22 matches + 14 gaps + 26 matches = querySize: 62 bp
GTCCATGCAATTTTAAGACTTG--------------AACCCCCTTGACTGATTACAGTCAGT query
|||||||||||||||||||||| |||||||||||||||||||||||||| midline
GTCCATGCAATTTTAAGACTTGAACCTGTGATCTGAAACCCCCTTGACTGATTACAGTCAGT subject
'''
# To store CIGAR representation
cigar_str = []
# Head clipping
if queryStart > 1:
cigar_str.append('%dH' % (queryStart - 1))
# Evaluate alignment position by position (always begin with a match)
curType = "="
prevType = "="
count = 0
cigarsum = 0
assert len(query) == querySize
length = len(query.replace('-', ''))
# this loops over the alignment positions
for i in range(querySize):
# Current position type (deletion, insertion, match or mismatch)
if query[i] == '-':
curType = 'D'
elif subject[i] == '-':
curType = 'I'
elif query[i] == subject[i]:
curType = '='
else:
curType = 'X'
if curType == prevType:
# Enlarge current segment
prevType = curType
count += 1
else:
# Write current segment and start a new one
cigar_str.append('%d%s' % (count, prevType))
if prevType in ['I', '=', 'X']:
cigarsum += count
prevType = curType
count = 1
# Write last group
cigar_str.append('%d%s' % (count, curType))
if curType in ['I', '=', 'X']:
cigarsum += count
# Tail clipping
if queryEnd < length:
# print(query, querySize, queryEnd, file=sys.stderr)
cigar_str.append('%dH' % (length - queryEnd))
assert cigarsum == length, '%s: cigar:%s\tcigarsum=%d,length=%d' % \
(query, ''.join(cigar_str), cigarsum, length)
# Join segments into a string
return ''.join(cigar_str)
# use itertools.tee() because we need the list twice
blast_records, blast_records_backup = tee(NCBIXML.parse(open(filein)))
# read once to parse general info
version = None
references = {}
for record in blast_records:
if not version:
version = record.version
application = record.application
if record.alignments == []:
continue
for alignment in record.alignments:
references[alignment.hit_def] = alignment.length
# print header
print('@HD\tVN:1.0\tSO:unsorted')
for k, v in references.items():
print('@SQ\tSN:%s\tLN:%d' % (k, v))
print('@PG\tID:%s\tVN:%s\tCL:%s' % (application, version, ' '.join(sys.argv)))
for record in blast_records_backup:
for alignment in record.alignments:
TC = len(alignment.hsps) # SAM TC flag: segments in template
for hsp in alignment.hsps:
to_print = copy.copy(sam_line)
to_print[0] = record.query
to_print[2] = alignment.hit_def
to_print[3] = min(hsp.sbjct_start, hsp.sbjct_end)
try:
mapq = int(-log10(hsp.expect))
except ValueError:
mapq = 127
if mapq > 254:
to_print[4] = 254
elif mapq < 0:
to_print[4] = 0
else:
to_print[4] = mapq
if NOMAPQ:
to_print[4] = 255
if hsp.frame == (1, -1):
to_print[1] |= 16
elif hsp.frame == (1, 1):
pass
else:
sys.exit('What strand?')
to_print[5] = cigar(hsp.sbjct, hsp.query, hsp.query_start,
hsp.query_end, hsp.align_length)
to_print[9] = hsp.query.replace('-', '')
to_print[10] = def_qual * len(to_print[9])
to_print = [str(t) for t in to_print]
print('\t'.join(to_print))
@zephyris
Copy link
Copy Markdown

This script throws an error on line 234 when the e value for a blast hit is zero. A simple exception mapping hsp.expect=0 to mapq=254 should fix this...

@ozagordi
Copy link
Copy Markdown
Author

ozagordi commented May 31, 2017

Hi. Sorry that I'm seeing this so late, I'm not even sure there are notifications on Gist.
In the version included in MinVar I map this to 127, but it's quite arbitrary. I'm not using the values anyway.

But thanks for pointing this out.

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment